NEET Q3 Unofficial Answer Key 2024 (Available)
Check the NEET Q3 Unofficial Answer Key 2024 PDF prepared with the help of subject matter experts. Candidates can cross-check their answers to calculate their raw score.
NEET Q3 Unofficial Answer Key 2024: Candidates who appeared for the NEET 2024 exam on May 5 can check the key for Set Q3. The answers have been added for all the 200 questions asked in the exam. NEET Q3 answer key 2024 (unofficial) has been prepared by the subject matter experts. Candidates can expect the official answer key to be released by 12 - 15 days after the completion of the exam. Until then candidates can make use of the NEET Q3 answer key 2024 (unofficial) to determine the marks obtained in the exam.
Also Read |
| Links | | ||
| NEET Answer Key 2024 Unofficial (All Sets) | NEET Question Paper 2024 | NEET 2024 Exam Analysis | 
| NEET Expected Rank 2024 | NEET Expected Percentile Score 2024 | NEET Expected Cutoff Score 2024 | 
Table of Contents |
NEET Q3 Unofficial Answer Key 2024 for Physics
Here is the unofficial NEET 2024 answer key for Set Code Q3 Physics subject:
Q3 Physics Section A
| Question Number | Set Q3 Correct Answer | Question Number | Set Q3 Correct Answer | 
| 1 | 2 | 19 | 1- (10) | 
| 2 | 3- There will be a central dark fringe surrounded by a few colored fringes | 20 | 2 | 
| 3 | 3- B | 21 | 1- 2µF | 
| 4 | 3- 8V | 22 | 1- Strain and angle | 
| 5 | 4- 1240π 2 | 23 | 1- 4mm | 
| 6 | 2- 52Ω | 24 | 1- AB and DC | 
| 7 | 3- 6N | 25 | 4- 3.92ms -2 | 
| 8 | 4- 4.4mT | 26 | 2- A-III, B-IV, C-II, D-I | 
| 9 | 2- 2:1 | 27 | 4- The reflected light will be completely polarised but the refracted light will be partially polarised | 
| 10 | 4- Linear Graph | 28 | 1- A-II, B-III, C-IV, D-I | 
| 11 | 2- Both I and II are correct statements | 29 | 2- 2:1 | 
| 12 | 2- 4T | 30 | 4- 286, 81 | 
| 13 | 3- Both A and B are correct | 31 | 2- 5m, 2s | 
| 14 | 1- Zero | 32 | 1- 19.8mN | 
| 15 | 4- Zero | 33 | 4- AND gate | 
| 16 | 1- 8.5 cm | 34 | 3- A is true but R is false | 
| 17 | 4- Varying velocity and varying acceleration | 35 | 2- Point P moves faster than point Q | 
| 18 | 2- A, B, C and D only | --- | --- | 
Q3 Physics Section B
| Question Number | Set Q3 Correct Answer | Question Number | Set Q3 Correct Answer | 
| 36 | 2- Displacement current of magnitude equal to I flows in the same direction as I | 44 | 1 (5GmM/6R) | 
| 37 | 4- They originate from charges moving with uniform speed | 45 | 2- A and C only | 
| 38 | 2- 28 | 46 | 2 - 0.93 A | 
| 39 | 2- 2:9 | 47 | 2- 50 × 10 3 N | 
| 40 | 4- P1 > P2 > P3 | 48 | 2 (M/2) | 
| 41 | 3 | 49 | 2- A, C and E only | 
| 42 | 1 | 50 | 2 | 
| 43 | 2- (√2) | --- | --- | 
Expected Cutoff |
NEET Q3 Unofficial Answer Key 2024 for Chemistry
Here is the unofficial NEET 2024 answer key for Set Code Q3 Chemistry subject:
Q3 Chemistry Section A
| Question Number | Set Q3 Correct Answer | Question Number | Set Q3 Correct Answer | 
| 51 | 3- (A-III, B-IV, C-II, D-I) | 69 | 3- A, C and D only | 
| 52 | 2- B>C>A | 70 | 4 | 
| 53 | 1- Both Statements I and II are correct | 71 | 2 (A-III, B-IV, C-I, D-II) | 
| 54 | 1 | 72 | 1 (B and D only) | 
| 55 | 1- Both Statements I and II are correct | 73 | 1 (4 mol of helium) | 
| 56 | 4 | 74 | 4 (Po) | 
| 57 | 4 | 75 | 3- d 4 to d 5 configuration | 
| 58 | To be updated | 76 | 3- B and E | 
| 59 | 2 (Li<B<Be<C< N) | 77 | 2 | 
| 60 | 4 | 78 | 1 | 
| 61 | 4- Rate constant at two different temperatures | 79 | 3- 2,3-dimethylbutane | 
| 62 | 1- Both Statements I and II are correct | 80 | 1- aqueous copper sulphate | 
| 63 | 1 (Si<C<N<O<F) | 81 | 4- (A-II, B-III, C-IV, D-I) | 
| 64 | 1 (A-II, B-IV, C-I, D-III) | 82 | 1 (Both Statement I and Statement II are true) | 
| 65 | 1 (A-II, B-III, C-IV, D-I) | 83 | 2- (Sublimation) | 
| 66 | 1 (A-I, B-IV, C-II, D-III) | 84 | 3- A-IV, B-I, C-II, D-III | 
| 67 | 4 | 85 | 3- Reaction has a tendency to go in backward direction | 
| 68 | 1- (-x) | --- | --- | 
Q3 Chemistry Section B
| Question Number | Set A3 Correct Answer | Question Number | Set A3 Correct Answer | 
| 86 | 1 | 94 | 1- 37°C | 
| 87 | 1- Both Statement I and Statement II are true | 95 | 4- Three canonical forms can be drawn for CO 2 3 − ion | 
| 88 | 2- 0.315 g | 96 | 1- propylamine | 
| 89 | 2 | 97 | 1- B, A, D, C, E | 
| 90 | 4- H 3 PO 3 and POCl 3 | 98 | 2- (–413.14 calories) | 
| 91 | 1- 38.04 kJ/mol | 99 | 4-- (0.717) | 
| 92 | 4- dilute sulphuric acid | 100 | 2- ABC 3 | 
| 93 | 1 | --- | --- | 
Upcoming Events of NEET 2024
NEET Q3 Unofficial Answer Key 2024 for Botany
Here is the unofficial NEET 2024 answer key for Set Code Q3 Botany subject:
Q3 Botany Section A
| Question Number | Set Q3 Correct Answer | Question Number | Set Q3 Correct Answer | 
| 101 | 2- Phospholipids | 119 | 2- Mode of Nutrition | 
| 102 | 4- 3 molecules of ATP and 2 molecules of NADPH | 120 | 4 (a- Perigynous; b- Perigynous) | 
| 103 | 2- 6 bp | 121 | 4- IUCN | 
| 104 | 1- C | 122 | 3- B and C only | 
| 105 | 1- Zinc | 123 | 3- A, C, D, and E only | 
| 106 | 1- Totipotency | 124 | 3- Competitive inhibition | 
| 107 | 1 (A- III, B-II, C-IV, D-I) | 125 | 3- Dedifferentiation | 
| 108 | 3- Statement I is true but statement II is false | 126 | 2- Metaphase | 
| 109 | 1- Datura | 127 | 1- A, C, D and E only | 
| 110 | 2- Biodiversity Conservation | 128 | 1- Both Statement I and II are correct | 
| 111 | 4- B, C, D and E only | 129 | 1- A-III, B-II, C-IV, D-I | 
| 112 | 3- Permease | 130 | 1- Inward curling of leaves in monocots. | 
| 113 | 3- A-III, B-I, C-IV, D-II | 131 | 2- Red flowered as well as pink flowered plants | 
| 114 | 3- Carrying Capacity | 132 | 4- Promotor, Structural gene, Terminator | 
| 115 | 3- Does not affect mature monocotyledonous plants | 133 | 2- bb | 
| 116 | 3- C | 134 | 3- C, D and E only | 
| 117 | 4 - Statement I is false but Statement II is true | 135 | 3- A-III, B-IV, C-I, D-II | 
| 118 | 4- A, B and D only | --- | --- | 
Q3 Botany Section B
| Question Number | Set Q3 Correct Answer | Question Number | Set Q3 Correct Answer | 
| 136 | Circular, double stranded | 144 | 1- A-IV, B-I, C-II, D-III | 
| 137 | 2- A-III, B-I, C-IV, D-II | 145 | 3- Succinyl-CoA → Succinic acid | 
| 138 | 1- A-II, B-IV, C-I, D-III | 146 | 3- Statement I is true but Statement II is false | 
| 139 | 4- The DNA dependent DNA polymerase catalyses polymerization in 5’ → 3’ direction | 147 | 1- A-IV, B-II, C-I, D-III | 
| 140 | 1- Wind pollinated plant inflorescence showing flowers with well exposed stamens | 148 | 2- A-III, B-IV, C-I, D-II | 
| 141 | 2- A-I, B-II, C-III, D-IV | 149 | 3-Protoplasts | 
| 142 | 3- A, C, D and E only | 150 | 2- Gibberellin | 
| 143 | 3 | --- | --- | 
NEET Q3 Unofficial Answer Key 2024 for Zoology
Here is the unofficial NEET 2024 answer key for Set Code A3 Zoology subject:
Q3 Zoology Section A
| Question Number | Set Q3 Correct Answer | Question Number | Set Q3 Correct Answer | 
| 151 | 1- (E-C-A-D-B) | 169 | 1- 5’AUGUACCGUUUAUAGGUAAGU3’ | 
| 152 | 2- 10th Segment | 170 | 2- (A-III, B-IV, C-II, D-I) | 
| 153 | 3- Convergent Evolution | 171 | 3- (A-II, B-IV, C-I, D-III) | 
| 154 | 1- Uterine Fundus | 172 | 4- Vaults | 
| 155 | 4 - (A-D-C-B) | 173 | 2 | 
| 156 | 4- Glucagon | 174 | 3- Bio-reactors are used to produce small scale bacterial cultures | 
| 157 | 3 -(A-III, B-IV, C-I, D-II) | 175 | 1- Both A and R are correct and R is the correct explanation of A | 
| 158 | 4 (E-C-A-D-B) | 176 | 2- High pO 2 and Lesser H + concentration | 
| 159 | 4- Constant gene pool | 177 | 3- A-III, B-I, C-II, D-IV | 
| 160 | 2- A, B & E only | 178 | 2- A only | 
| 161 | 2 (A-IV, B-III, C-I, D-II) | 179 | 4- A-III, B-I, C-IV, D-II | 
| 162 | 1 (A-II, B-IV, C-I, D-III) | 180 | 2- Both Statement I and Statement II are false | 
| 163 | 3- A-III, B-IV, C-I, D-II | 181 | 2- The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of Plasmid | 
| 164 | 4- A is false but R is false | 182 | 4- A-II, B-I, C-IV, D-III | 
| 165 | 2- (A-II, B-I, C-IV, D-III) | 183 | 2- A-III, B-I, C-II, D-IV | 
| 166 | 3- A-II, B-IV, C-I, D-III | 184 | 4-A-III, B-I, C-IV, D-II | 
| 167 | 3- Tumor inducing plasmid | 185 | 3- Statement I is true but Statement II is false | 
| 168 | 4- (A-III, B-IV, C-I, D-II) | --- | --- | 
Q3 Zoology Section B
| Question Number | Correct Answer | Question Number | Correct Answer | 
| 186 | 4- Statement I is false but Statement II is true | 194 | 4- A-III, B-I, C-IV, D-II | 
| 187 | 1- A-IV, B-II, C-III, D-I | 195 | 3- A-III, B-IV, C-I, D-II | 
| 188 | 3- B, D & E only | 196 | 4- A-IV, B-III, C-I, D-II | 
| 189 | 3- Loop of Henle of juxta medullary nephron runs deep into medulla | 197 | 1- A only | 
| 190 | 3- Statement I is correct but Statement II is incorrect | 198 | 2- A-III, B-II, C-IV, D-I | 
| 191 | 1- Both Statement I and Statement II are correct | 199 | 3- Statement I is correct but Statement Il is incorrect | 
| 192 | 1- E, A, D, C, B | 200 | 4- A-III, B-IV, C-I, D-II | 
| 193 | 1- FSH, Leydig cells, Sertoli cells, Spermiogenesis | --- | --- | 
NEET Set-Wise Unofficial Answer key
| Set Code | Answer Key Link | 
| Set Q1 | NEET Q1 Unofficial Answer Key 2024 | 
| Set Q2 | NEET Q2 Unofficial Answer Key 2024 | 
| Set Q4 | NEET Q4 Unofficial Answer Key 2024 | 
| Set Q5 | NEET Q5 Unofficial Answer Key 2024 | 
| Set Q6 | NEET Q6 Unofficial Answer Key 2024 | 
NEET Expected Rank Analysis 2024
| Marks Range | Detailed Expected Rank Analysis | 
| 100 to 149 | NEET 2024 Expected Rank for 100 to 149 Marks | 
| 150 to 199 | NEET 2024 Expected Rank for 150 to 199 Marks | 
| 200 to 249 | NEET 2024 Expected Rank for 200 to 249 Marks | 
| 250 to 299 | NEET 2024 Expected Rank for 250 to 299 Marks | 
| 300 | 300 Marks in NEET 2024 means which rank? | 
| 310 | 310 Marks in NEET 2024 means which rank? | 
| 320 | 320 Marks in NEET 2024 means which rank? | 
| 660 | 660 Marks in NEET 2024 means which rank? | 
| 670 | 670 Marks in NEET 2024 means which rank? | 
| 680 | 680 Marks in NEET 2024 means which rank? | 
| 690 | 690 Marks in NEET 2024 means which rank? | 
| 700 | NEET Rank 2024 for 700 Marks | 
NEET Expected Percentile Analysis 2024
Keep visiting CollegeDekho for the latest Education News on entrance exams, board exams and admissions. You can also write to us at our email ID news@collegedekho.com.