Prepare for the upcoming exams with a variety of sample papers & previous year question papers.

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
We are glad that you have successfully downloaded the document you needed. We hope that the information provided will be helpful and informative.
Error! Please Check Inputs

Get direct link to download answer key

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
We are glad that you have successfully downloaded the document you needed. We hope that the information provided will be helpful and informative.
Error! Please Check Inputs

NEET T3 Unofficial Answer Key 2024 (Available)

Appeared for Set Code T3 paper? Download here NEET T3 Unofficial Answer Key 2024 in PDF format and cross-check your answers to calculate your raw score.

Predict your Rank

Get direct link to download answer key

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
We are glad that you have successfully downloaded the document you needed. We hope that the information provided will be helpful and informative.
Error! Please Check Inputs

NEET T3 Unofficial Answer Key 2024: The answer key for NEET Set Code T3 2024, covering all 200 questions, is now available and is being updated one by one on this page. Test takers can use the table of contents to quickly access the answer key for Physics, Chemistry, Botany, and Zoology subjects.

Also Read |

Table of Contents |

NEET T3 Unofficial Answer Key 2024 for Botany

Here is the unofficial NEET 2024 answer key for Set Code T3 Botany subject:

T3 Botany Section A

Question Number Set T3 Correct Answer Question Number Set T3 Correct Answer
101 (2) B, C, D and E only 119 (4) Red flowered as well as pink flowered plants
102 (4) Biodiversity Conservation 120 (1) A-III B-IV C-I D-II
103 (1) Competitive Inhibition 121 To be updated
104 (2) D 122 1) A-III B-I C-IV D-II
105 (3) Inward curling of leaves in monocots 123 (3) C
106 (1) C, D and E only 124 (3) Datura
107 (1) Dedifferentiation 125 (2) Promoter, Structural gene, Terminator
108 To be updated 126 (1) B and C only
109 (3) A, C, D and E only 127 (1) does not affect mature monocotyledonous plants
110 (4) Mode of Nutrition 128 (3) Zinc
111 (2) 3 molecules of ATP and 2 molecules of NADPH 129 (10) Permease
112 (2) A, B and D only 130 (4) A, C, D, and E only
113 (3) Totopotency 131 (1) Statement I is true but Statement II is false
114 (1) Carrying capacity 132 (2) Statement I is false, But Statement II is true
115 (4) Metaphase 133 (3) Both Statement I and Statement II are true
116 (2) a-Perigynous, b- Perigynous 134 (3) A-III B-II C-IV D-I
117 (4) bb 135 (2) iUCN
118 To be updated --- ---

T3 Botany Section B

Question Number Set T3 Correct Answer Question Number Set T3 Correct Answer
136 (4) Circular double stranded 144 (4) A-II B-I C-IV D-III
137 (1) Protoplasts 145 (2) The DNA Dependent DNA polymerase catalysts polymerization in '5'-3' direction
138 (3) Wind-pollinated plant inflorescence showing flowers with well exposed stamens 146 (4)
139 (4) Gibberellin 147 (3) A-II B-IV C-I D-III
140 (4) A-III B-IV C-I D-II 148 (4) A-IIIB-I C-IV- D-II
141 To be updated 149 To be updated
142 (1) Statement I is true but Statement II is false 150 (1) A, C, D and E only
143 (1) Succinyl-CoA- Succinic acid --- ---

Expected Cutoff |

NEET T3 Unofficial Answer Key 2024 for Zoology

Here is the unofficial NEET 2024 answer key for Set Code T3 Zoology subject:

T3 Zoology Section A

Question Number Set T3 Correct Answer Question Number Set T3 Correct Answer
151 To be updated 169 (4) Both A and R are true but R is NOT the correct explanation of A.
152 (2) A-III B-I  C-IV D-II 170 (4) The gene 'X' is responsible for controlling the copy number of the linked DNA and 'Y' for protein involved in the replication of Plasmid.
153 (1) Statement I is true but Statement II is fase 171 (1) A-II, B-I, C-III, D-IV (2) A-III, B-IV, C-I, D-II
154 (4) A-IV, B-III, C-I, D-II 172 (4) A only
155 (4) A-III, B-IV, C-II, D-I 173 (2) Statement I is false but Statement II is true
156 (2) Glucagon 174 (2) A-III, B-1, C-IV, D-II
157 (3) 5' AUGUACCGUUAUAGGUAAGU3' 175 (2) Vaults
158 (4) (a) Skeletal- Triceps
(b) Smooth – Stomach
(c) Cardiac- Heart
176 (4) A-II, B-1, C-IV, D-III
159 (2) E-C-A-D-B 177 (2) A-II B-I C-IV D-III
160 (4) A, B and E only 178 (1) Bio-reactors are used to produce small scale bacterial cultures.
161 (1) A-II, B-IV, C-1, D-III 179 (1) A-II B-IV C-1 D-III
162 (1) Convergent evolution 180 (1) A-III, B-I, C-II, D-IV
163 (3) A-II, B-IV, C-I, D-III 181 (3) Both A and R are correct and R is the correct explanation of A
164 2 Constant gene pool 182 (4) A-III, B-I, C-II, D-IV
165 (2) A-D-C-B 183 (1) Tumor inducing plasmid.
166 (3) E-C-A-D-B 184 (2) Ampulla
167 (4) High pO2 and Lesser H+ concentration 185 (1) A-III, B-IV, C-I, D-II
168 (1) A-III, B-IV, C-L, D-II --- ---

T3 Zoology Section B

Question Number Correct Answer Question Number Correct Answer
186 (1) A-III B-IV C-I D-II 194 (3) A-IV, B-II, C-III, D-I
187 (2) A-III, B-I, C-IV, D-II 195 (1) Loop of Henle of adjacent medullary nephron runs deep into medulla.
188 (1) Statement I is correct but Statement II is incorrect. 196 (4) A-III, B-II, C-IV, D-I
189 (3) FSH, Leydig cells, Sertoli cells, spermiogenesis 197 (3) A only
190 (2) A-IV B-III C-I D-II 198 (2) Statement I is false but Statement II is true
191 (2) A-III, B-IV, C-I, D-II 199 (3) E, A, D, C, B
192 (1) A-III, B-IV, C-I, D-II 200 (1) Statement I is correct but Statement II is incorrect
193 (1) Statement I is correct but Statement II is incorrect. --- ---

Upcoming Events of NEET 2024

NEET T3 Unofficial Answer Key 2024 for Chemistry

Here is the unofficial NEET 2024 answer key for Set Code T3 Chemistry subject:

T3 Chemistry Section A

Question Number Set T3 Correct Answer Question Number Set T3 Correct Answer
51 (3) A-II, B-IV, C-I, D-III 69 (1) B and E
52 (2) BaCl2 + Na2SO4  BaSO4 + 2NaCl 70 (1) A – III ; B – IV ; C – II ; D – I
53 (3) 71 (2) PO
54 (3) aqueous copper sulphate 72 (1) Reaction has a tendency to go in backward direction.
55 (4) 250 mg 73 2
56 (3) A-I, B-IV, C-II, D-III 74 3
57 (3) d5 to d4 configuration 75 3
58 (2) A-II, B-III, C-IV, D-I 76 2
59 (2) rate constant at two different temperature. 77 3
60 (1) 2,3-dimethylbutane 78 1
61 (3) B and D only 79 4
62 (3) Si < C < N < O < F 80 (3) A-II, B-III, C-IV, D-I
63 (2) 81 (3) Both Statement I and Statement II are true.
64 (3) Both statement I and Statement II are true. 82 (4) Li < B < Be < C < N
65 (3) Both statement I and Statement II are true. 83 3
66 (4) A – III, B – IV, C – I, D – II 84 2
67 (1) 85 4
68 (4) (i) BH3, (ii) H2O2/OH, (iii) PCC --- ---

T3 Chemistry Section B

Question Number Set T3 Correct Answer Question Number Set T3 Correct Answer
86 4 94 3
87 3 95 3
88 4 96 (2) 0.717
89 4 97 (4) –413.14 calories
90 3 98 (4) 0.315 g
91 2 99 3
92 2 100 3
93 3 --- ---

NEET T3 Unofficial Answer Key 2024 for Physics

Here is the unofficial NEET 2024 answer key for Set Code T3 Physics subject:

T3 Physics Section A

Question Number Set T3 Correct Answer Question Number Set T3 Correct Answer
1 (1) 4.4 mT 19 4
2 To be updated 20 4
3 (3) zero 21 2
4 (1) both the reflected and refracted light will be completely polarised 22 2
5 (3) 1: 2 23 2
6 (1) overline B 24 2
7 (3) 1/10N 25 3
8 3 26 4
9 1 27 2
10 (1) there will be a central bright white fringe surrounded by a few coloured fringes 28 3
11 2 29 2
12 (3) 2uF 30 4
13 3 31 4
14 3 32 3
15 4 33 2
16 1 34 4
17 3 35 4
18 1 --- ---

T3 Physics Section B

Question Number Set T3 Correct Answer Question Number Set T3 Correct Answer
36 2 44 4
37 4 45 4
38 2 46 4
39 3 47 1
40 4 48 4
41 4 49 3
42 4 50 1
43 4 --- ---

NEET Set-Wise Unofficial Answer Key 2024

NEET Expected Rank Analysis 2024

NEET Expected Percentile Analysis 2024

Keep visiting CollegeDekho for the latest Education News on entrance exams, board exams and admissions. You can also write to us at our email ID news@collegedekho.com.

Get Help From Our Expert Counsellors

Get Counselling from experts, free of cost!

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
Thank you! Our counsellor will soon be in touch with you to guide you through your admissions journey!
Error! Please Check Inputs

Be the First to Know

Get Access to Latest Updates

Stay updated on important announcements on dates, events and notification

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
Thank You! We shall keep you posted on the latest updates!
Error! Please Check Inputs

Do you have a question? Ask us.

  • Typical response between 24-48 hours

  • Get personalized response

  • Free of Cost

  • Access to community

Recent News

Talk To Us

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
We are glad that you have successfully downloaded the document you needed. We hope that the information provided will be helpful and informative.
Error! Please Check Inputs