Prepare for the upcoming exams with a variety of sample papers & previous year question papers.

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
We are glad that you have successfully downloaded the document you needed. We hope that the information provided will be helpful and informative.
Error! Please Check Inputs

Get direct link to download answer key

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
We are glad that you have successfully downloaded the document you needed. We hope that the information provided will be helpful and informative.
Error! Please Check Inputs

NEET T3 Unofficial Answer Key 2024 (Available)

Appeared for Set Code T3 paper? Download here NEET T3 Unofficial Answer Key 2024 in PDF format and cross-check your answers to calculate your raw score.

Predict your Rank

Get direct link to download answer key

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
We are glad that you have successfully downloaded the document you needed. We hope that the information provided will be helpful and informative.
Error! Please Check Inputs

NEET T3 Unofficial Answer Key 2024:The answer key for NEET Set Code T3 2024, covering all 200 questions, is now available and is being updated one by one on this page. Test takers can use the table of contents to quickly access the answer key for Physics, Chemistry, Botany, and Zoology subjects.

Also Read |

Table of Contents |

NEET T3 Unofficial Answer Key 2024 for Botany

Here is the unofficial NEET 2024 answer key for Set Code T3 Botany subject:

T3 Botany Section A

Question NumberSet T3 Correct AnswerQuestion NumberSet T3 Correct Answer
101(2) B, C, D and E only119(4) Red flowered as well as pink flowered plants
102(4) Biodiversity Conservation120(1) A-III B-IV C-I D-II
103(1) Competitive Inhibition121To be updated
104(2) D1221) A-III B-I C-IV D-II
105(3) Inward curling of leaves in monocots123(3) C
106(1) C, D and E only124(3) Datura
107(1) Dedifferentiation125(2) Promoter, Structural gene, Terminator
108To be updated126(1) B and C only
109(3) A, C, D and E only127(1) does not affect mature monocotyledonous plants
110(4) Mode of Nutrition128(3) Zinc
111(2) 3 molecules of ATP and 2 molecules of NADPH129(10) Permease
112(2) A, B and D only130(4) A, C, D, and E only
113(3) Totopotency131(1) Statement I is true but Statement II is false
114(1) Carrying capacity132(2) Statement I is false, But Statement II is true
115(4) Metaphase133(3) Both Statement I and Statement II are true
116(2) a-Perigynous, b- Perigynous134(3) A-III B-II C-IV D-I
117(4) bb135(2) iUCN
118To be updated------

T3 Botany Section B

Question NumberSet T3 Correct AnswerQuestion NumberSet T3 Correct Answer
136(4) Circular double stranded144(4) A-II B-I C-IV D-III
137(1) Protoplasts145(2) The DNA Dependent DNA polymerase catalysts polymerization in '5'-3' direction
138(3) Wind-pollinated plant inflorescence showing flowers with well exposed stamens146(4)
139(4) Gibberellin147(3) A-II B-IV C-I D-III
140(4) A-III B-IV C-I D-II148(4) A-IIIB-I C-IV- D-II
141To be updated149To be updated
142(1) Statement I is true but Statement II is false150(1) A, C, D and E only
143(1) Succinyl-CoA- Succinic acid------

Expected Cutoff |

NEET T3 Unofficial Answer Key 2024 for Zoology

Here is the unofficial NEET 2024 answer key for Set Code T3 Zoology subject:

T3 Zoology Section A

Question NumberSet T3 Correct AnswerQuestion NumberSet T3 Correct Answer
151To be updated169(4) Both A and R are true but R is NOT the correct explanation of A.
152(2) A-III B-I C-IV D-II170(4) The gene 'X' is responsible for controlling the copy number of the linked DNA and 'Y' for protein involved in the replication of Plasmid.
153(1) Statement I is true but Statement II is fase171(1) A-II, B-I, C-III, D-IV (2) A-III, B-IV, C-I, D-II
154(4) A-IV, B-III, C-I, D-II172(4) A only
155(4) A-III, B-IV, C-II, D-I173(2) Statement I is false but Statement II is true
156(2) Glucagon174(2) A-III, B-1, C-IV, D-II
157(3) 5' AUGUACCGUUAUAGGUAAGU3'175(2) Vaults
158(4) (a) Skeletal- Triceps
(b) Smooth – Stomach
(c) Cardiac- Heart
176(4) A-II, B-1, C-IV, D-III
159(2) E-C-A-D-B177(2) A-II B-I C-IV D-III
160(4) A, B and E only178(1) Bio-reactors are used to produce small scale bacterial cultures.
161(1) A-II, B-IV, C-1, D-III179(1) A-II B-IV C-1 D-III
162(1) Convergent evolution180(1) A-III, B-I, C-II, D-IV
163(3) A-II, B-IV, C-I, D-III181(3) Both A and R are correct and R is the correct explanation of A
1642 Constant gene pool182(4) A-III, B-I, C-II, D-IV
165(2) A-D-C-B183(1) Tumor inducing plasmid.
166(3) E-C-A-D-B184(2) Ampulla
167(4) High pO2 and Lesser H+ concentration185(1) A-III, B-IV, C-I, D-II
168(1) A-III, B-IV, C-L, D-II------

T3 Zoology Section B

Question NumberCorrect AnswerQuestion NumberCorrect Answer
186(1) A-III B-IV C-I D-II194(3) A-IV, B-II, C-III, D-I
187(2) A-III, B-I, C-IV, D-II195(1) Loop of Henle of adjacent medullary nephron runs deep into medulla.
188(1) Statement I is correct but Statement II is incorrect.196(4) A-III, B-II, C-IV, D-I
189(3) FSH, Leydig cells, Sertoli cells, spermiogenesis197(3) A only
190(2) A-IV B-III C-I D-II198(2) Statement I is false but Statement II is true
191(2) A-III, B-IV, C-I, D-II199(3) E, A, D, C, B
192(1) A-III, B-IV, C-I, D-II200(1) Statement I is correct but Statement II is incorrect
193(1) Statement I is correct but Statement II is incorrect.------

Upcoming Events of NEET 2024

NEET T3 Unofficial Answer Key 2024 for Chemistry

Here is the unofficial NEET 2024 answer key for Set Code T3 Chemistry subject:

T3 Chemistry Section A

Question NumberSet T3 Correct AnswerQuestion NumberSet T3 Correct Answer
51(3) A-II, B-IV, C-I, D-III69(1) B and E
52(2) BaCl2 + Na2SO4  BaSO4 + 2NaCl70(1) A – III ; B – IV ; C – II ; D – I
53(3)71(2) PO
54(3) aqueous copper sulphate72(1) Reaction has a tendency to go in backward direction.
55(4) 250 mg732
56(3) A-I, B-IV, C-II, D-III743
57(3) d5 to d4 configuration753
58(2) A-II, B-III, C-IV, D-I762
59(2) rate constant at two different temperature.773
60(1) 2,3-dimethylbutane781
61(3) B and D only794
62(3) Si < C < N < O < F80(3) A-II, B-III, C-IV, D-I
63(2)81(3) Both Statement I and Statement II are true.
64(3) Both statement I and Statement II are true.82(4) Li < B < Be < C < N
65(3) Both statement I and Statement II are true.833
66(4) A – III, B – IV, C – I, D – II842
67(1)854
68(4) (i) BH3, (ii) H2O2/OH, (iii) PCC------

T3 Chemistry Section B

Question NumberSet T3 Correct AnswerQuestion NumberSet T3 Correct Answer
864943
873953
88496(2) 0.717
89497(4) –413.14 calories
90398(4) 0.315 g
912993
9221003
933------

NEET T3 Unofficial Answer Key 2024 for Physics

Here is the unofficial NEET 2024 answer key for Set Code T3 Physics subject:

T3 Physics Section A

Question NumberSet T3 Correct AnswerQuestion NumberSet T3 Correct Answer
1(1) 4.4 mT194
2To be updated204
3(3) zero212
4(1) both the reflected and refracted light will be completely polarised222
5(3) 1: 2232
6(1) overline B242
7(3) 1/10N253
83264
91272
10(1) there will be a central bright white fringe surrounded by a few coloured fringes283
112292
12(3) 2uF304
133314
143323
154332
161344
173354
181------

T3 Physics Section B

Question NumberSet T3 Correct AnswerQuestion NumberSet T3 Correct Answer
362444
374454
382464
393471
404484
414493
424501
434------

NEET Set-Wise Unofficial Answer Key 2024

NEET Expected Rank Analysis 2024

NEET Expected Percentile Analysis 2024

Keep visiting CollegeDekho for the latest Education News on entrance exams, board exams and admissions. You can also write to us at our email ID news@collegedekho.com.

Get Help From Our Expert Counsellors

Get Counselling from experts, free of cost!

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
Thank you! Our counsellor will soon be in touch with you to guide you through your admissions journey!
Error! Please Check Inputs

Be the First to Know

Get Access to Latest Updates

Stay updated on important announcements on dates, events and notification

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
Thank You! We shall keep you posted on the latest updates!
Error! Please Check Inputs

Do you have a question? Ask us.

  • Typical response between 24-48 hours

  • Get personalized response

  • Free of Cost

  • Access to community

Talk To Us

  • By proceeding ahead you expressly agree to the CollegeDekho terms of use and privacy policy
  • Why register with us?

    Stay up-to date with Exam Notification and NewsGet Exam Date AlertsGet free Sample Papers & Mock TestYou won’t get unwanted calls from third parties
We are glad that you have successfully downloaded the document you needed. We hope that the information provided will be helpful and informative.
Error! Please Check Inputs