NEET Q4 Unofficial Answer Key 2024 (Available)

Chinmayai Bobade

Updated On: May 06, 2024 04:02 PM

Appeared for Set Code Q4 paper? Download here NEET Q4 Unofficial Answer Key 2024 in PDF format and cross-check your answers to calculate your raw score.
NEET Q4 Unofficial Answer Key 2024NEET Q4 Unofficial Answer Key 2024

NEET Q4 Unofficial Answer Key 2024: The answers for all 200 questions solved by the subject experts for NEET Set Code Q4 question paper 2024 are provided here. Access the links from the table of contents to jump to the respective subject answer key.

Also Read |

Links |
NEET Answer Key 2024 Unofficial (All Sets) NEET Question Paper 2024 NEET 2024 Exam Analysis
NEET Expected Rank 2024 NEET Expected Percentile Score 2024 NEET Expected Cutoff Score 2024

Table of Contents |

  1. NEET Q4 Unofficial Answer Key 2024 for Botany
  2. NEET Q4 Unofficial Answer Key 2024 for Zoology
  3. NEET Q4 Unofficial Answer Key 2024 for Chemistry
  4. NEET Q4 Unofficial Answer Key 2024 for Physics
  5. NEET Set-Wise Unofficial Answer Key 2024

NEET Q4 Unofficial Answer Key 2024 for Botany

Here is the unofficial NEET 2024 answer key for Set Code Q4 Botany subject:

Q4 Botany Section A

Question Number Set Q4 Correct Answer Question Number Set Q4 Correct Answer
101 (3) docs not affect mature monocotyledonous plants. 119 (2) bb
102 (4) 3 molecules of ATP and 2 molecules of NADPH 120 (1) A, C, D, and E only
103 (1) C 121 (4) A, B, and D only
104 (1) A-III, B-II, C-IV, D-I 122 (4) Promotor, Structural Gene, Terminator
105 (4) (a) Perigynous, (b) Perigynous 123 (2) 6 bp
106 (1) A-III, B-II, C-IV, D-I 124 (1) Zinc
107 (1) Datura 125 (3) A-III, B-I, C-IV, D-II
108 (4) B, C, D, and E only 126 (4) IUCN
109 (2) Red flowered as well as pink flowered plants 127 (2) Biodiversity conversion
110 (3) Dedifferentiation 128 (1) Totipotency
111 (3) A-III, B-IV, C-I, D-II (Out of syllabus question) 129 (3) Carrying Capacity
112 (3_ C, D, and E only 130 (1) Inward curling of leaves in monocots
113 (1) Both Statement I and Statement II are true 131 (2) Phospholipids
114 (2) Metaphase 132 (3) Competitive Inhibition
115 (3) B and C only 133 (3) Statement I is true but Statement II is false
116 (3) Permease 134 (3) C
117 (4) Statement I is false but Statement II is true 135 (2) A, C, D, and E only
118 (2) Mode of nutrition --- ---

Q4 Botany Section B

Question Number Set Q4 Correct Answer Question Number Set Q4 Correct Answer
136 (2) A-II, B-I, C-IV, D-III 144 (2) A-III, B-IV, C-I, D-II
137 (2) A-III, B-I, C-IV, D-II 145 (1) Wind-pollinated plant inflorescence showing flowers with well-exposed stamens
138 (2) x (kcalm -2 ) yr -1 146 (2) Circlular, double stranded
139 (3) A, C, D, and E only 147 (3) Statement I is true but Statement II is false
140 (2) Gibberellin 148 (1) A-IV, B-I, C-II, D-III
141 (1) A-IV, B-II, C-I, D-III 149 (1) A-II, B-IV, C-I, D-III
142 (4) The DNA-dependent DNA polymerase catalyses polymerization in 5'→3' direction. 150 (3) Protoplasts
143 (3) Succinyl-CoA → Succinic acid --- ---

Expected Cutoff |

Links |
NEET General Category Expected Cutoff 2024 NEET EWS Category Expected Cutoff 2024
NEET OBC Category Expected Cutoff 2024 NEET SC Category Expected Cutoff 2024

NEET Q4 Unofficial Answer Key 2024 for Zoology

Here is the unofficial NEET 2024 answer key for Set Code Q4 Zoology subject:

Q4 Zoology Section A

Question Number Set Q4 Correct Answer Question Number Set Q4 Correct Answer
151 (2) A-II, B-I, C-IV, D-III 169 (3) A, B, and E only
152 (4) E-C-A-D-B 170 (2) A-III, B-I, C-II, D-IV
153 (3) A-III, B-I, C-III, D-I 171 (4) A is false but R is true
154 (2) A-IV, B-III, C-I, D-II 172 (2) A-II, B-IV, C-I, D-III
155 (3) Convergent Evolution 173 (4) A-II, B-I, C-IV, D-III
156 (1) E-C-A-D-B 174 (3) A-II, B-IV, C-I, D-III
157 (2) Bio-reactors are used to produce small scale bacterial cultures 175 (2) A only
158 (1) Uterine Fundus 176 (3) A-III, B-IV, C-I, D-III
159 (1) Both Statement I and Statement II are false 177 (4) A-III, B-I, C-IV, D-II
160 (4) Constant gene pool 178 (2) (a) Skeletal - Triceps
(b) Smooth - Stomach
(c) Cardiac - Heart
161 (4) Glucagon 179 (3) A-III, B-IV, C-I, D-II
162 (4) A-III, B-I, C-IV, D-II 180 (2) High pO2 and lesser H+ concentration
163 (2) 10th segment 181 (4) A-D-C-B
164 (1) A-II, B-IV, C-I, D-III 182 (4) A-III, B-IV, C-I, D-II
165 (2) A-III, B-IV, C-II, D-I 183 (1) Both A and R are true and
R is the correct explanation of A
166 (3) Statement I is true but Statement II is false 184 (4) Valuts
167 (2) The gene 'X' is responsible for controlling the copy number of the linked DNA
and 'Y' for protein involved in the replication of Plasmid.
185 (3) Tumor inducing plasmid
168 (2) 5' AUGUACCGUUUAUAGGUAAGU --- ---

Q4 Zoology Section B

Question Number Correct Answer Question Number Correct Answer
186 (4) A-III, B-IV, C-I, D-II 194 (4) A-III, B-I, C-IV, D-II
187 (3) Statement I is true but Statement II is false 195 (1) A only
188 (1) E-A-D-C-B 196 (4) Statement I is false but Statement II is true
189 (1) A-IV, B-II, C-III, D-I 197 (1) Both Statement I and Statement II are true
190 (2) B, D, and E only 198 (3) A-III, B-IV, C-I, D-II
191 (3) Loop of Henle of juxta medullary nephron runs deep into medula 199 (4) A-IV, B-III, C-I, D-II
192 (3) Statement I is true but Statement II is false 200 (1) FSH, Leydig cells, Sertoli cells, spermiogencsis
193 (2) A-III, B-II, C-IV, D-I --- ---

Upcoming Events of NEET 2024

Links
NEET OMR Response Sheet Expected Release Date 2024
NEET Result 2024 Release Date

NEET Q4 Unofficial Answer Key 2024 for Chemistry

Here is the unofficial NEET 2024 answer key for Set Code Q4 Chemistry subject:

Q4 Chemistry Section A

Question Number Set Q4 Correct Answer Question Number Set Q4 Correct Answer
51 (4) Po 69 (3) B and E
52 (3) A-III, B-IV, C-II, D-I 70 (4) A, C and D
53 (1) Aqueous copper sulphate 71 (3) A-IV, B-I, C-II, D-III
54 (1) A-II, B-IV, C-I, D-III 72 (1) Both Statement I and Statement II are true
55 (2) (i) BH 3
(ii) H 2 O 2 / OH -
(iii) PCC
73 (3) Reaction has a tendency to go in backward direction.
56 (1) 74 (2) A-III, B-IV, C-I, D-II
57 (4) rate constant at two different temperatures 75 (3) 2,3-dimethylbutane
58 (1) A-II, B-III, C-IV, D-I 76 (2) Sublimation
59 (@) 250 mg 77 (4)
60 (1) Si < C < N < O < F 78 (1) Both Statement I and Statement II are true
61 (4) A-II, B-III, C-IV, D-I 79 (4) BaCl 2 + Na 2 SO 4 → BaSO 4 + 2NaCl
62 (4) 80 (1) A-I, B-IV, C-II, D-III
63 (1) - x 81 (2) Li < B < Be < C < N
64 (4) 82 (1) B and D only
65 (2) B > C > A 83 (3) d 4 to d 5 configuration
66 (4) 84 (1) 4 mol of helium
67 (1) 85 (1) Both Statement I and Statement II are true
68 (1) Both Statement I and Statement II are true --- ---

Q4 Chemistry Section B

Question Number Set Q4 Correct Answer Question Number Set Q4 Correct Answer
86 (1) Ce 4+ ad Yb 2+ 94 (4) Dilute sulphuric acid
87 (1) B, A, D, C, E 95 (4) Three canonical forms can be drawn for CO 3 2- ion.
88 (1) 96 (1) 38.04 kJ/mol
89 (4) 413.4 calories 97 (2)
90 (1) propylamine 98 (2) 310°C
91 (4) H 3 PO 3 and POCl 3 99 (1) Both Statement I and Statement II are true
92 (2) 0.315 g 100 (4) 0.717
93 (2) ABC 3 --- ---

NEET Q4 Unofficial Answer Key 2024 for Physics

Here is the unofficial NEET 2024 answer key for Set Code Q4 Physics subject:

Q4 Physics Section A

Question Number Set Q4 Correct Answer Question Number Set Q4 Correct Answer
1 (4) zero 19 (1) strain and angle
2 (3) OR gate 20 (3) both the reflected and refracted light
will be completely polarized
3 (3) there will be a central bright white fringe surrounded by a few coloured fringes 21 (3) A is true but R is false.
4 (2) 1 / 100(N + 1) 22 (2) Point P moves faster than point Q.
5 (1) 4 mm 23 (2) 5 m, 2s
6 (1) 8.5 cm 24 (3) B bar
7 (3) 4.4 mT 25 (2) A, B, C, and D only
8 (1) 10 26 (2) 4T
9 (2) 2:1 27 (3) 8 V
10 (3) 6 N 28 (4) 1280 π 2
11 (4) 3.92 m s -2 29 (2) 52 ohm
12 (1) A is correct but B is incorrect 30 (1) A-II, B-III, C-4, D-1
13 (2) √5/2 31 (4) 286, 81
14 (1) Both Statement I and Statement II are true 32 (4)
15 (1) 19.8 mN 33 (2) 2:1
16 (1) AB and DC 34 (1) zero
17 (4) Varying velocity and varying acceleration 35 (1) 2 µF
18 (2) A-III, B-IV, C-II, D-I --- ---

Q4 Physics Section B

Question Number Set Q4 Correct Answer Question Number Set Q4 Correct Answer
36 (2) A, C, and E only 44 (3)
37 (2) 0.93 A 45 (2) 28
38 (2) αt/β 46 (1) 5GmM/6R
39 (4) P 1 > P 2 > P 3 47 (2) √2
40 (2) M/2 48 (3) A, C, and D only
41 (2) displacement current of magnitude equal to I flows in the same direction as I. 49 (2) 2 : 9
42 (2) 50 x 10 3 N 50 (4) they originate from charges moving with uniform speed.
43 (4) --- ---

NEET Set-Wise Unofficial Answer Key 2024

Set Code Answer Key Link
Set Q1 NEET Q1 Unofficial Answer Key 2024
Set Q2 NEET Q2 Unofficial Answer Key 2024
Set Q3 NEET Q3 Unofficial Answer Key 2024
Set Q5 NEET Q5 Unofficial Answer Key 2024
Set Q6 NEET Q6 Unofficial Answer Key 2024

NEET Expected Rank Analysis 2024

Marks Range Detailed Expected Rank Analysis
100 to 149 NEET 2024 Expected Rank for 100 to 149 Marks
150 to 199 NEET 2024 Expected Rank for 150 to 199 Marks
200 to 249 NEET 2024 Expected Rank for 200 to 249 Marks
250 to 299 NEET 2024 Expected Rank for 250 to 299 Marks
300 300 Marks in NEET 2024 means which rank?
310 310 Marks in NEET 2024 means which rank?
320 320 Marks in NEET 2024 means which rank?
660 660 Marks in NEET 2024 means which rank?
670 670 Marks in NEET 2024 means which rank?
680 680 Marks in NEET 2024 means which rank?
690 690 Marks in NEET 2024 means which rank?
700 NEET Rank 2024 for 700 Marks

NEET Expected Percentile Analysis 2024

Marks Range Detailed Expected Percentile Analysis
150 to 199 Expected Percentile for 150 to 199 Marks in NEET 2024
200 to 249 Expected Percentile for 200 to 249 Marks in NEET 2024
250 to 299 Expected Percentile for 250 to 299 Marks in NEET 2024
300 Expected Percentile for 300 Marks in NEET 2024
310 Expected Percentile for 310 Marks in NEET 2024
320 Expected Percentile for 320 Marks in NEET 2024
660 Expected Percentile for 660 Marks in NEET 2024
670 Expected Percentile for 670 Marks in NEET 2024
680 Expected Percentile for 680 Marks in NEET 2024
690 Expected Percentile for 690 Marks in NEET 2024
700 Expected Percentile for 700 Marks in NEET 2024

Keep visiting CollegeDekho for the latest Education News on entrance exams, board exams and admissions. You can also write to us at our email ID news@collegedekho.com.

/news/neet-q4-unofficial-answer-key-2024-available-52530/

Do you have a question? Ask us.

  • Typical response between 24-48 hours

  • Get personalized response

  • Free of Cost

  • Access to community

Top