NEET R3 Unofficial Answer Key 2024: The National Testing Agency (NTA) conducted the NEET exam today, May 5, 2024. Since the examination has concluded, candidates who have appeared for the exam can check out the answers for all 200 questions here. The NEET R3 Answer key 2024 (unofficial) has been prepared with the help of subject matter experts. The key for all the subjects has been added below. Candidates can click the link in the 'Table of Contents' to get directed to the subject-wise answer key.
Also Read |
Links | | ||
---|---|---|
NEET Answer Key 2024 Unofficial (All Sets) | NEET Question Paper 2024 | NEET 2024 Exam Analysis |
NEET Expected Rank 2024 | NEET Expected Percentile Score 2024 | NEET Expected Cutoff Score 2024 |
Table of Contents |
NEET R3 Unofficial Answer Key 2024 for Zoology
Here is the unofficial NEET 2024 answer key for Set Code R3 Zoology subject:
R3 Zoology Section A
Question Number | Set R3 Correct Answer | Question Number | Set R3 Correct Answer |
---|---|---|---|
151 | (3) | 169 | (3) |
152 | (2) | 170 | (3) |
153 | (2) | 171 | (2) |
154 | (1) | 172 | (1) |
155 | (2) | 173 | (3) |
156 | (3) | 174 | (4) |
157 | (1) | 175 | (1) A only |
158 | (1) | 176 | (3) A-IV, B-II, C-I, D-II |
159 | (3) | 177 | (2) A-IV, B-I, C-II, D-III |
160 | (2) | 178 | (1) A-III, B-IV, C-II, D-I |
161 | (3) | 179 | (3) Gene 'X' is responsible for recognition sites and 'Y' is responsible for antibiotic resistance. |
162 | (3) | 180 | (3) Statement I is false but Statement II is true |
163 | (1) | 181 | (4) Both A and R are correct, and R is the correct explanation of A |
164 | (3) | 182 | (4) E-C-A-D-B |
165 | (4) | 183 | (2) 5'AUGUAAAGUUUAUAGGUAAGU3 |
166 | (1) | 184 | (1) A-III, B-1, C-II, D-IV |
167 | (2) | 185 | (2) Tumor inducing plasmid |
168 | (2) | --- | --- |
R3 Zoology Section B
Question Number | Correct Answer | Question Number | Correct Answer |
---|---|---|---|
186 | (1) A-III, B-II, C-IV, D-I | 194 | (4) E, A, D, C, and B |
187 | (4) Both Statements I and II are true. | 195 | (2) B, D, and E only |
188 | (4) Both Statement 1 and Statement Il are correct. | 196 | (4) A-IV, B-II, C-III, D-I |
189 | 2) Loop of Henle of juxta medullary nephron runs deep into medulla | 197 | (2) Statement 1 is correct but Statement II is incorrect |
190 | (3) A-III, B-IV, C-I, and D-II | 198 | (4) A-II, B-I, C-III, D-IV |
191 | (2) A-III, B-IV, C-I, and D-II | 199 | (4) A only |
192 | (3) A-IV, B-III, C-I, and D-II | 200 | (4) Both Statement I and Statement II are correct |
193 | (4) FSH, Leydick cells, Sertoli cells, spermiogenesis | --- | --- |
Expected Cutoff |
Links | | |
---|---|
NEET General Category Expected Cutoff 2024 | NEET EWS Category Expected Cutoff 2024 |
NEET OBC Category Expected Cutoff 2024 | NEET SC Category Expected Cutoff 2024 |
NEET R3 Unofficial Answer Key 2024 for Chemistry
Here is the unofficial NEET 2024 answer key for Set Code R3 Chemistry subject:
R3 Chemistry Section A
Q | A | Q | A |
---|---|---|---|
51 | (3) | 69 | (1) |
52 | (2) | 70 | (2) |
53 | (4) | 71 | (4) |
54 | (4) | 72 | (4) |
55 | (3) | 73 | (2) |
56 | (2) | 74 | (4) |
57 | (4) | 75 | (3) |
58 | (2) | 76 | (2) |
59 | (4) | 77 | (4) |
60 | (3) | 78 | (3) |
61 | (3) | 79 | (3) |
62 | (1) | 80 | (1) |
63 | (1) | 81 | (1) |
64 | (2) | 82 | (4) |
65 | (4) | 83 | (3) |
66 | (4) | 84 | (3) |
67 | (3) | 85 | (1) |
68 | (1) | --- | --- |
R3 Chemistry Section B
Question Number | Set R3 Correct Answer | Question Number | Set R3 Correct Answer |
---|---|---|---|
86 | (3) | 94 | (2) E, C, D, B, A |
87 | (1) | 95 | (1) -413.14 calories |
88 | (3) | 96 | (2) |
89 | (4) | 97 | (1) 380.4 kJ/mol |
90 | (2) butanamide | 98 | (3) dilute sulphuric acid |
91 | (1) Ce3+ and Eu2- | 99 | (4) 37°C |
92 | (4) | 100 | (4) Three resonance structures can be drawn for ozone. |
93 | (4) ABC3 | --- | --- |
Upcoming Events of NEET 2024
Links |
---|
NEET OMR Response Sheet Expected Release Date 2024 |
NEET Result 2024 Release Date |
NEET R3 Unofficial Answer Key 2024 for Physics
The unofficial NEET 2024 answer key for Set Code R3 Physics subject has been provided here:
R3 Physics Section A
Question Number | Set R3 Correct Answer | Question Number | Set R3 Correct Answer |
---|---|---|---|
1 | (4) | 19 | (2) 1:1 |
2 | (2) | 20 | (2) 1.98 mN |
3 | (3) | 21 | (4) 4 mm |
4 | (4) | 22 | (3) 3.92 ms-2 |
5 | (4) | 23 | (3) 10 (N + 1) |
6 | (3) | 24 | (4) Both Statements I and II are correct |
7 | (3) | 25 | (2) 6 N |
8 | (3) | 26 | (4) Strain and Angle |
9 | (2) | 27 | (4) 8.5 cm |
10 | (4) | 28 | (4) A is correct but B is incorrect |
11 | (1) | 29 | (3) 60 ohms |
12 | (2) | 30 | (1) 5 m, 2s |
13 | (2) | 31 | (4) A and B only |
14 | (3) | 32 | (1) A-III, B-IV, C-II, D-1 |
15 | (3) | 33 | (2) 2 |
16 | (1) | 34 | (4) 5 |
17 | (1) Point P moves faster than Point A | 35 | (1) 4T |
18 | (4) Zero | --- | --- |
R3 Physics Section B
Question Number | Set R3 Correct Answer | Question Number | Set R3 Correct Answer |
---|---|---|---|
36 | (3) 2 * 103 N | 44 | (2) A, C, and D only |
37 | (4) | 45 | (2) |
38 | (1) 28 | 46 | (1) Displacement current of magnitude equal to I flows in the same direction as I. |
39 | (3) | 47 | (1) |
40 | (1) 0.93 A | 48 | (1) |
41 | (1) 2:9 | 49 | (3) |
42 | (2) | 50 | (4) |
43 | (3) they originate with charges moving with uniform speed. | --- | --- |
NEET R3 Unofficial Answer Key 2024 for Botany
The following table displays NEET 2024 answer key for Set Code R3 Botany subject:
R3 Botany Section A
Question Number | Set R3 Correct Answer | Question Number | Set R3 Correct Answer |
---|---|---|---|
101 | (3) Promotor, Structural Gene, Terminator | 119 | (4) |
102 | (1) A, B, C, and D only | 120 | (2) |
103 | (1) Phospholipids | 121 | (4) In situ conservation |
104 | (3) A, B, and D only | 122 | (2) A-III, B-IV, C-I, D-II |
105 | (2) | 123 | (2) Dedifferentiation |
106 | (4) | 124 | (2) Anaphase |
107 | (2) | 125 | (1) bb |
108 | (3) | 126 | (1) Red-flowered as well as pink-flowered plants |
109 | (3) | 127 | (2) Competitive Inhibition |
110 | (2) | 128 | (4) Both Statement I and Statement II are true |
111 | (4) | 129 | (4) C |
112 | (1) | 130 | (1) A, C, D, and E only |
113 | (4) | 131 | (3) D |
114 | (4) | 132 | (4) Promotes apical dominance |
115 | (3) | 133 | (4) Both Statement I and Statement II are true |
116 | (4) | 134 | (4) Totipotency |
117 | (2) | 135 | (3) Statement I is false but Statement II is true |
118 | (1) | --- | --- |
R3 Botany Section B
Question Number | Set R3 Correct Answer | Question Number | Set R3 Correct Answer |
---|---|---|---|
136 | (1) Gibberellin | 144 | (2) 10x (kcal m²) yr-1 |
137 | (4) Both Statement I and Statement II are true | 145 | (2) A-IV, B-III, C-II, D-I |
138 | (1) A-IV, B-I, C-II, D-III | 146 | (2) A-I, B-II, C-IV, D-III |
139 | (2) A, C, D, and E only | 147 | (2) |
140 | (3) The DNA dependent DNA polymerase catalyses polymerization in 5'→3' direction. | 148 | (1) |
141 | (4) Malic acid → Oxaloacetic acid | 149 | (1) |
142 | (3) A-III, B-IV, C-II, D-I | 150 | (1) |
143 | (4) Wind pollinated plant inflorescence showing flowers with well exposed stamens. | --- | --- |
NEET Set-Wise Answer Key 2024
Set Code | Answer Key Link |
---|---|
Set R1 | NEET R1 Unofficial Answer Key 2024 |
Set R2 | NEET R2 Unofficial Answer Key 2024 |
Set R4 | NEET R4 Unofficial Answer Key 2024 |
Set R5 | NEET R5 Unofficial Answer Key 2024 |
Set R6 | NEET R6 Unofficial Answer Key 2024 |
NEET Expected Rank Analysis 2024
NEET Expected Percentile Analysis 2024