Appeared for Set Code T3 paper? Download here NEET T3 Unofficial Answer Key 2024 in PDF format and cross-check your answers to calculate your raw score.
NEET T3 Unofficial Answer Key 2024NEET T3 Unofficial Answer Key 2024: The answer key for NEET Set Code T3 2024, covering all 200 questions, is now available and is being updated one by one on this page. Test takers can use the table of contents to quickly access the answer key for Physics, Chemistry, Botany, and Zoology subjects.
Also Read |
| Links | | ||
|---|---|---|
| NEET Answer Key 2024 Unofficial (All Sets) | NEET Question Paper 2024 | NEET 2024 Exam Analysis |
| NEET Expected Rank 2024 | NEET Expected Percentile Score 2024 | NEET Expected Cutoff Score 2024 |
Table of Contents |
NEET T3 Unofficial Answer Key 2024 for Botany
Here is the unofficial NEET 2024 answer key for Set Code T3 Botany subject:
T3 Botany Section A
| Question Number | Set T3 Correct Answer | Question Number | Set T3 Correct Answer |
|---|---|---|---|
| 101 | (2) B, C, D and E only | 119 | (4) Red flowered as well as pink flowered plants |
| 102 | (4) Biodiversity Conservation | 120 | (1) A-III B-IV C-I D-II |
| 103 | (1) Competitive Inhibition | 121 | To be updated |
| 104 | (2) D | 122 | 1) A-III B-I C-IV D-II |
| 105 | (3) Inward curling of leaves in monocots | 123 | (3) C |
| 106 | (1) C, D and E only | 124 | (3) Datura |
| 107 | (1) Dedifferentiation | 125 | (2) Promoter, Structural gene, Terminator |
| 108 | To be updated | 126 | (1) B and C only |
| 109 | (3) A, C, D and E only | 127 | (1) does not affect mature monocotyledonous plants |
| 110 | (4) Mode of Nutrition | 128 | (3) Zinc |
| 111 | (2) 3 molecules of ATP and 2 molecules of NADPH | 129 | (10) Permease |
| 112 | (2) A, B and D only | 130 | (4) A, C, D, and E only |
| 113 | (3) Totopotency | 131 | (1) Statement I is true but Statement II is false |
| 114 | (1) Carrying capacity | 132 | (2) Statement I is false, But Statement II is true |
| 115 | (4) Metaphase | 133 | (3) Both Statement I and Statement II are true |
| 116 | (2) a-Perigynous, b- Perigynous | 134 | (3) A-III B-II C-IV D-I |
| 117 | (4) bb | 135 | (2) iUCN |
| 118 | To be updated | --- | --- |
T3 Botany Section B
| Question Number | Set T3 Correct Answer | Question Number | Set T3 Correct Answer |
|---|---|---|---|
| 136 | (4) Circular double stranded | 144 | (4) A-II B-I C-IV D-III |
| 137 | (1) Protoplasts | 145 | (2) The DNA Dependent DNA polymerase catalysts polymerization in '5'-3' direction |
| 138 | (3) Wind-pollinated plant inflorescence showing flowers with well exposed stamens | 146 | (4) |
| 139 | (4) Gibberellin | 147 | (3) A-II B-IV C-I D-III |
| 140 | (4) A-III B-IV C-I D-II | 148 | (4) A-IIIB-I C-IV- D-II |
| 141 | To be updated | 149 | To be updated |
| 142 | (1) Statement I is true but Statement II is false | 150 | (1) A, C, D and E only |
| 143 | (1) Succinyl-CoA- Succinic acid | --- | --- |
Expected Cutoff |
| Links | | |
|---|---|
| NEET General Category Expected Cutoff 2024 | NEET EWS Category Expected Cutoff 2024 |
| NEET OBC Category Expected Cutoff 2024 | NEET SC Category Expected Cutoff 2024 |
NEET T3 Unofficial Answer Key 2024 for Zoology
Here is the unofficial NEET 2024 answer key for Set Code T3 Zoology subject:
T3 Zoology Section A
| Question Number | Set T3 Correct Answer | Question Number | Set T3 Correct Answer |
|---|---|---|---|
| 151 | To be updated | 169 | (4) Both A and R are true but R is NOT the correct explanation of A. |
| 152 | (2) A-III B-I C-IV D-II | 170 | (4) The gene 'X' is responsible for controlling the copy number of the linked DNA and 'Y' for protein involved in the replication of Plasmid. |
| 153 | (1) Statement I is true but Statement II is fase | 171 | (1) A-II, B-I, C-III, D-IV (2) A-III, B-IV, C-I, D-II |
| 154 | (4) A-IV, B-III, C-I, D-II | 172 | (4) A only |
| 155 | (4) A-III, B-IV, C-II, D-I | 173 | (2) Statement I is false but Statement II is true |
| 156 | (2) Glucagon | 174 | (2) A-III, B-1, C-IV, D-II |
| 157 | (3) 5' AUGUACCGUUAUAGGUAAGU3' | 175 | (2) Vaults |
| 158 |
(4) (a) Skeletal- Triceps
(b) Smooth – Stomach (c) Cardiac- Heart | 176 | (4) A-II, B-1, C-IV, D-III |
| 159 | (2) E-C-A-D-B | 177 | (2) A-II B-I C-IV D-III |
| 160 | (4) A, B and E only | 178 | (1) Bio-reactors are used to produce small scale bacterial cultures. |
| 161 | (1) A-II, B-IV, C-1, D-III | 179 | (1) A-II B-IV C-1 D-III |
| 162 | (1) Convergent evolution | 180 | (1) A-III, B-I, C-II, D-IV |
| 163 | (3) A-II, B-IV, C-I, D-III | 181 | (3) Both A and R are correct and R is the correct explanation of A |
| 164 | 2 Constant gene pool | 182 | (4) A-III, B-I, C-II, D-IV |
| 165 | (2) A-D-C-B | 183 | (1) Tumor inducing plasmid. |
| 166 | (3) E-C-A-D-B | 184 | (2) Ampulla |
| 167 | (4) High pO2 and Lesser H+ concentration | 185 | (1) A-III, B-IV, C-I, D-II |
| 168 | (1) A-III, B-IV, C-L, D-II | --- | --- |
T3 Zoology Section B
| Question Number | Correct Answer | Question Number | Correct Answer |
|---|---|---|---|
| 186 | (1) A-III B-IV C-I D-II | 194 | (3) A-IV, B-II, C-III, D-I |
| 187 | (2) A-III, B-I, C-IV, D-II | 195 | (1) Loop of Henle of adjacent medullary nephron runs deep into medulla. |
| 188 | (1) Statement I is correct but Statement II is incorrect. | 196 | (4) A-III, B-II, C-IV, D-I |
| 189 | (3) FSH, Leydig cells, Sertoli cells, spermiogenesis | 197 | (3) A only |
| 190 | (2) A-IV B-III C-I D-II | 198 | (2) Statement I is false but Statement II is true |
| 191 | (2) A-III, B-IV, C-I, D-II | 199 | (3) E, A, D, C, B |
| 192 | (1) A-III, B-IV, C-I, D-II | 200 | (1) Statement I is correct but Statement II is incorrect |
| 193 | (1) Statement I is correct but Statement II is incorrect. | --- | --- |
Upcoming Events of NEET 2024
| Links |
|---|
| NEET OMR Response Sheet Expected Release Date 2024 |
| NEET Result 2024 Release Date |
NEET T3 Unofficial Answer Key 2024 for Chemistry
Here is the unofficial NEET 2024 answer key for Set Code T3 Chemistry subject:
T3 Chemistry Section A
| Question Number | Set T3 Correct Answer | Question Number | Set T3 Correct Answer |
|---|---|---|---|
| 51 | (3) A-II, B-IV, C-I, D-III | 69 | (1) B and E |
| 52 | (2) BaCl2 + Na2SO4 BaSO4 + 2NaCl | 70 | (1) A – III ; B – IV ; C – II ; D – I |
| 53 | (3) | 71 | (2) PO |
| 54 | (3) aqueous copper sulphate | 72 | (1) Reaction has a tendency to go in backward direction. |
| 55 | (4) 250 mg | 73 | 2 |
| 56 | (3) A-I, B-IV, C-II, D-III | 74 | 3 |
| 57 | (3) d5 to d4 configuration | 75 | 3 |
| 58 | (2) A-II, B-III, C-IV, D-I | 76 | 2 |
| 59 | (2) rate constant at two different temperature. | 77 | 3 |
| 60 | (1) 2,3-dimethylbutane | 78 | 1 |
| 61 | (3) B and D only | 79 | 4 |
| 62 | (3) Si < C < N < O < F | 80 | (3) A-II, B-III, C-IV, D-I |
| 63 | (2) | 81 | (3) Both Statement I and Statement II are true. |
| 64 | (3) Both statement I and Statement II are true. | 82 | (4) Li < B < Be < C < N |
| 65 | (3) Both statement I and Statement II are true. | 83 | 3 |
| 66 | (4) A – III, B – IV, C – I, D – II | 84 | 2 |
| 67 | (1) | 85 | 4 |
| 68 | (4) (i) BH3, (ii) H2O2/OH, (iii) PCC | --- | --- |
T3 Chemistry Section B
| Question Number | Set T3 Correct Answer | Question Number | Set T3 Correct Answer |
|---|---|---|---|
| 86 | 4 | 94 | 3 |
| 87 | 3 | 95 | 3 |
| 88 | 4 | 96 | (2) 0.717 |
| 89 | 4 | 97 | (4) –413.14 calories |
| 90 | 3 | 98 | (4) 0.315 g |
| 91 | 2 | 99 | 3 |
| 92 | 2 | 100 | 3 |
| 93 | 3 | --- | --- |
NEET T3 Unofficial Answer Key 2024 for Physics
Here is the unofficial NEET 2024 answer key for Set Code T3 Physics subject:
T3 Physics Section A
| Question Number | Set T3 Correct Answer | Question Number | Set T3 Correct Answer |
|---|---|---|---|
| 1 | (1) 4.4 mT | 19 | 4 |
| 2 | To be updated | 20 | 4 |
| 3 | (3) zero | 21 | 2 |
| 4 | (1) both the reflected and refracted light will be completely polarised | 22 | 2 |
| 5 | (3) 1: 2 | 23 | 2 |
| 6 | (1) overline B | 24 | 2 |
| 7 | (3) 1/10N | 25 | 3 |
| 8 | 3 | 26 | 4 |
| 9 | 1 | 27 | 2 |
| 10 | (1) there will be a central bright white fringe surrounded by a few coloured fringes | 28 | 3 |
| 11 | 2 | 29 | 2 |
| 12 | (3) 2uF | 30 | 4 |
| 13 | 3 | 31 | 4 |
| 14 | 3 | 32 | 3 |
| 15 | 4 | 33 | 2 |
| 16 | 1 | 34 | 4 |
| 17 | 3 | 35 | 4 |
| 18 | 1 | --- | --- |
T3 Physics Section B
| Question Number | Set T3 Correct Answer | Question Number | Set T3 Correct Answer |
|---|---|---|---|
| 36 | 2 | 44 | 4 |
| 37 | 4 | 45 | 4 |
| 38 | 2 | 46 | 4 |
| 39 | 3 | 47 | 1 |
| 40 | 4 | 48 | 4 |
| 41 | 4 | 49 | 3 |
| 42 | 4 | 50 | 1 |
| 43 | 4 | --- | --- |
NEET Set-Wise Unofficial Answer Key 2024
| Set Code | Answer Key Link |
| Set T1 | NEET T1 Unofficial Answer Key 2024 |
| Set T2 | NEET T2 Unofficial Answer Key 2024 |
| Set T4 | NEET T4 Unofficial Answer Key 2024 |
| Set T5 | NEET T5 Unofficial Answer Key 2024 |
| Set T6 | NEET T6 Unofficial Answer Key 2024 |
NEET Expected Rank Analysis 2024
| Marks Range | Detailed Expected Rank Analysis |
|---|---|
| 100 to 149 | NEET 2024 Expected Rank for 100 to 149 Marks |
| 150 to 199 | NEET 2024 Expected Rank for 150 to 199 Marks |
| 200 to 249 | NEET 2024 Expected Rank for 200 to 249 Marks |
| 250 to 299 | NEET 2024 Expected Rank for 250 to 299 Marks |
| 300 | 300 Marks in NEET 2024 means which rank? |
| 310 | 310 Marks in NEET 2024 means which rank? |
| 320 | 320 Marks in NEET 2024 means which rank? |
| 660 | 660 Marks in NEET 2024 means which rank? |
| 670 | 670 Marks in NEET 2024 means which rank? |
| 680 | 680 Marks in NEET 2024 means which rank? |
| 690 | 690 Marks in NEET 2024 means which rank? |
| 700 | NEET Rank 2024 for 700 Marks |
NEET Expected Percentile Analysis 2024
Keep visiting CollegeDekho for the latest Education News on entrance exams, board exams and admissions. You can also write to us at our email ID news@collegedekho.com.











