NEET T3 Unofficial Answer Key 2024 (Available)

Mahima Gupta

Updated On: May 06, 2024 04:39 PM

Appeared for Set Code T3 paper? Download here NEET T3 Unofficial Answer Key 2024 in PDF format and cross-check your answers to calculate your raw score.

NEET T3 Unofficial Answer Key 2024NEET T3 Unofficial Answer Key 2024

NEET T3 Unofficial Answer Key 2024: The answer key for NEET Set Code T3 2024, covering all 200 questions, is now available and is being updated one by one on this page. Test takers can use the table of contents to quickly access the answer key for Physics, Chemistry, Botany, and Zoology subjects.

Also Read |

Links |
NEET Answer Key 2024 Unofficial (All Sets) NEET Question Paper 2024 NEET 2024 Exam Analysis
NEET Expected Rank 2024 NEET Expected Percentile Score 2024 NEET Expected Cutoff Score 2024

Table of Contents |

  1. NEET T3 Unofficial Answer Key 2024 for Botany
  2. NEET T3 Unofficial Answer Key 2024 for Zoology
  3. NEET T3 Unofficial Answer Key 2024 for Chemistry
  4. NEET T3 Unofficial Answer Key 2024 for Physics
  5. NEET Set-Wise Unofficial Answer Key 2024

NEET T3 Unofficial Answer Key 2024 for Botany

Here is the unofficial NEET 2024 answer key for Set Code T3 Botany subject:

T3 Botany Section A

Question Number Set T3 Correct Answer Question Number Set T3 Correct Answer
101 (2) B, C, D and E only 119 (4) Red flowered as well as pink flowered plants
102 (4) Biodiversity Conservation 120 (1) A-III B-IV C-I D-II
103 (1) Competitive Inhibition 121 To be updated
104 (2) D 122 1) A-III B-I C-IV D-II
105 (3) Inward curling of leaves in monocots 123 (3) C
106 (1) C, D and E only 124 (3) Datura
107 (1) Dedifferentiation 125 (2) Promoter, Structural gene, Terminator
108 To be updated 126 (1) B and C only
109 (3) A, C, D and E only 127 (1) does not affect mature monocotyledonous plants
110 (4) Mode of Nutrition 128 (3) Zinc
111 (2) 3 molecules of ATP and 2 molecules of NADPH 129 (10) Permease
112 (2) A, B and D only 130 (4) A, C, D, and E only
113 (3) Totopotency 131 (1) Statement I is true but Statement II is false
114 (1) Carrying capacity 132 (2) Statement I is false, But Statement II is true
115 (4) Metaphase 133 (3) Both Statement I and Statement II are true
116 (2) a-Perigynous, b- Perigynous 134 (3) A-III B-II C-IV D-I
117 (4) bb 135 (2) iUCN
118 To be updated --- ---

T3 Botany Section B

Question Number Set T3 Correct Answer Question Number Set T3 Correct Answer
136 (4) Circular double stranded 144 (4) A-II B-I C-IV D-III
137 (1) Protoplasts 145 (2) The DNA Dependent DNA polymerase catalysts polymerization in '5'-3' direction
138 (3) Wind-pollinated plant inflorescence showing flowers with well exposed stamens 146 (4)
139 (4) Gibberellin 147 (3) A-II B-IV C-I D-III
140 (4) A-III B-IV C-I D-II 148 (4) A-IIIB-I C-IV- D-II
141 To be updated 149 To be updated
142 (1) Statement I is true but Statement II is false 150 (1) A, C, D and E only
143 (1) Succinyl-CoA- Succinic acid --- ---

Expected Cutoff |

Links |
NEET General Category Expected Cutoff 2024 NEET EWS Category Expected Cutoff 2024
NEET OBC Category Expected Cutoff 2024 NEET SC Category Expected Cutoff 2024

NEET T3 Unofficial Answer Key 2024 for Zoology

Here is the unofficial NEET 2024 answer key for Set Code T3 Zoology subject:

T3 Zoology Section A

Question Number Set T3 Correct Answer Question Number Set T3 Correct Answer
151 To be updated 169 (4) Both A and R are true but R is NOT the correct explanation of A.
152 (2) A-III B-I C-IV D-II 170 (4) The gene 'X' is responsible for controlling the copy number of the linked DNA and 'Y' for protein involved in the replication of Plasmid.
153 (1) Statement I is true but Statement II is fase 171 (1) A-II, B-I, C-III, D-IV (2) A-III, B-IV, C-I, D-II
154 (4) A-IV, B-III, C-I, D-II 172 (4) A only
155 (4) A-III, B-IV, C-II, D-I 173 (2) Statement I is false but Statement II is true
156 (2) Glucagon 174 (2) A-III, B-1, C-IV, D-II
157 (3) 5' AUGUACCGUUAUAGGUAAGU3' 175 (2) Vaults
158 (4) (a) Skeletal- Triceps
(b) Smooth – Stomach
(c) Cardiac- Heart
176 (4) A-II, B-1, C-IV, D-III
159 (2) E-C-A-D-B 177 (2) A-II B-I C-IV D-III
160 (4) A, B and E only 178 (1) Bio-reactors are used to produce small scale bacterial cultures.
161 (1) A-II, B-IV, C-1, D-III 179 (1) A-II B-IV C-1 D-III
162 (1) Convergent evolution 180 (1) A-III, B-I, C-II, D-IV
163 (3) A-II, B-IV, C-I, D-III 181 (3) Both A and R are correct and R is the correct explanation of A
164 2 Constant gene pool 182 (4) A-III, B-I, C-II, D-IV
165 (2) A-D-C-B 183 (1) Tumor inducing plasmid.
166 (3) E-C-A-D-B 184 (2) Ampulla
167 (4) High pO2 and Lesser H+ concentration 185 (1) A-III, B-IV, C-I, D-II
168 (1) A-III, B-IV, C-L, D-II --- ---

T3 Zoology Section B

Question Number Correct Answer Question Number Correct Answer
186 (1) A-III B-IV C-I D-II 194 (3) A-IV, B-II, C-III, D-I
187 (2) A-III, B-I, C-IV, D-II 195 (1) Loop of Henle of adjacent medullary nephron runs deep into medulla.
188 (1) Statement I is correct but Statement II is incorrect. 196 (4) A-III, B-II, C-IV, D-I
189 (3) FSH, Leydig cells, Sertoli cells, spermiogenesis 197 (3) A only
190 (2) A-IV B-III C-I D-II 198 (2) Statement I is false but Statement II is true
191 (2) A-III, B-IV, C-I, D-II 199 (3) E, A, D, C, B
192 (1) A-III, B-IV, C-I, D-II 200 (1) Statement I is correct but Statement II is incorrect
193 (1) Statement I is correct but Statement II is incorrect. --- ---

Upcoming Events of NEET 2024

Links
NEET OMR Response Sheet Expected Release Date 2024
NEET Result 2024 Release Date

NEET T3 Unofficial Answer Key 2024 for Chemistry

Here is the unofficial NEET 2024 answer key for Set Code T3 Chemistry subject:

T3 Chemistry Section A

Question Number Set T3 Correct Answer Question Number Set T3 Correct Answer
51 (3) A-II, B-IV, C-I, D-III 69 (1) B and E
52 (2) BaCl2 + Na2SO4  BaSO4 + 2NaCl 70 (1) A – III ; B – IV ; C – II ; D – I
53 (3) 71 (2) PO
54 (3) aqueous copper sulphate 72 (1) Reaction has a tendency to go in backward direction.
55 (4) 250 mg 73 2
56 (3) A-I, B-IV, C-II, D-III 74 3
57 (3) d5 to d4 configuration 75 3
58 (2) A-II, B-III, C-IV, D-I 76 2
59 (2) rate constant at two different temperature. 77 3
60 (1) 2,3-dimethylbutane 78 1
61 (3) B and D only 79 4
62 (3) Si < C < N < O < F 80 (3) A-II, B-III, C-IV, D-I
63 (2) 81 (3) Both Statement I and Statement II are true.
64 (3) Both statement I and Statement II are true. 82 (4) Li < B < Be < C < N
65 (3) Both statement I and Statement II are true. 83 3
66 (4) A – III, B – IV, C – I, D – II 84 2
67 (1) 85 4
68 (4) (i) BH3, (ii) H2O2/OH, (iii) PCC --- ---

T3 Chemistry Section B

Question Number Set T3 Correct Answer Question Number Set T3 Correct Answer
86 4 94 3
87 3 95 3
88 4 96 (2) 0.717
89 4 97 (4) –413.14 calories
90 3 98 (4) 0.315 g
91 2 99 3
92 2 100 3
93 3 --- ---

NEET T3 Unofficial Answer Key 2024 for Physics

Here is the unofficial NEET 2024 answer key for Set Code T3 Physics subject:

T3 Physics Section A

Question Number Set T3 Correct Answer Question Number Set T3 Correct Answer
1 (1) 4.4 mT 19 4
2 To be updated 20 4
3 (3) zero 21 2
4 (1) both the reflected and refracted light will be completely polarised 22 2
5 (3) 1: 2 23 2
6 (1) overline B 24 2
7 (3) 1/10N 25 3
8 3 26 4
9 1 27 2
10 (1) there will be a central bright white fringe surrounded by a few coloured fringes 28 3
11 2 29 2
12 (3) 2uF 30 4
13 3 31 4
14 3 32 3
15 4 33 2
16 1 34 4
17 3 35 4
18 1 --- ---

T3 Physics Section B

Question Number Set T3 Correct Answer Question Number Set T3 Correct Answer
36 2 44 4
37 4 45 4
38 2 46 4
39 3 47 1
40 4 48 4
41 4 49 3
42 4 50 1
43 4 --- ---

NEET Set-Wise Unofficial Answer Key 2024

Set Code Answer Key Link
Set T1 NEET T1 Unofficial Answer Key 2024
Set T2 NEET T2 Unofficial Answer Key 2024
Set T4 NEET T4 Unofficial Answer Key 2024
Set T5 NEET T5 Unofficial Answer Key 2024
Set T6 NEET T6 Unofficial Answer Key 2024

NEET Expected Rank Analysis 2024

Marks Range Detailed Expected Rank Analysis
100 to 149 NEET 2024 Expected Rank for 100 to 149 Marks
150 to 199 NEET 2024 Expected Rank for 150 to 199 Marks
200 to 249 NEET 2024 Expected Rank for 200 to 249 Marks
250 to 299 NEET 2024 Expected Rank for 250 to 299 Marks
300 300 Marks in NEET 2024 means which rank?
310 310 Marks in NEET 2024 means which rank?
320 320 Marks in NEET 2024 means which rank?
660 660 Marks in NEET 2024 means which rank?
670 670 Marks in NEET 2024 means which rank?
680 680 Marks in NEET 2024 means which rank?
690 690 Marks in NEET 2024 means which rank?
700 NEET Rank 2024 for 700 Marks

NEET Expected Percentile Analysis 2024

Marks Range Detailed Expected Percentile Analysis
150 to 199 Expected Percentile for 150 to 199 Marks in NEET 2024
200 to 249 Expected Percentile for 200 to 249 Marks in NEET 2024
250 to 299 Expected Percentile for 250 to 299 Marks in NEET 2024
300 Expected Percentile for 300 Marks in NEET 2024
310 Expected Percentile for 310 Marks in NEET 2024
320 Expected Percentile for 320 Marks in NEET 2024
660 Expected Percentile for 660 Marks in NEET 2024
670 Expected Percentile for 670 Marks in NEET 2024
680 Expected Percentile for 680 Marks in NEET 2024
690 Expected Percentile for 690 Marks in NEET 2024
700 Expected Percentile for 700 Marks in NEET 2024

Keep visiting CollegeDekho for the latest Education News on entrance exams, board exams and admissions. You can also write to us at our email ID news@collegedekho.com.

/news/neet-t3-unofficial-answer-key-2024-available-52519/

Do you have a question? Ask us.

  • Typical response between 24-48 hours

  • Get personalized response

  • Free of Cost

  • Access to community

Top